Review



h08h critical  (Sino Biological)


Bioz Verified Symbol Sino Biological is a verified supplier
Bioz Manufacturer Symbol Sino Biological manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 95
      Buy from Supplier

    Structured Review

    Sino Biological h08h critical
    H08h Critical, supplied by Sino Biological, used in various techniques. Bioz Stars score: 95/100, based on 15 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/h08h+critical/Human+c-MET+%2F+HGFR+Protein/pm41856115-223-59-58
    Average 95 stars, based on 15 article reviews
    h08h critical - by Bioz Stars, 2026-10
    95/100 stars

    Images

    Related Articles

    Recombinant:

    Article Title: TREM2 Is a Receptor for β-Amyloid that Mediates Microglial Function.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-Ab1-12 (B436) (Huang et al., 2016) N/A Rabbit anti-human TREM2 Cell Signaling Technology Cat# 91068 RRID:AB_2721119 Goat anti-human TREM2 R&D Systems Cat# AF1828 RRID:AB_2208689 Sheep anti-mouse TREM2 R&D Systems Cat# AF1729 RRID:AB_354956) Mouse anti-Myc Thermo Fisher Scientific Cat# 13-2500 RRID:AB_2533008 Mouse anti-Gas6 Santa Cruz Biotechnology Cat# sc-376087 RRID:AB_10989223 Rabbit anti-phospho-SYK Thermo Fisher Scientific Cat# MA5-14918 RRID:AB_10989513 Rabbit anti-SYK Cell Signaling Technology Cat# 13198 RRID:AB_2687924 Rabbit anti-DAP12 Cell Signaling Technology Cat# 12492 RRID:AB_2721120 Mouse anti-b-actin Sigma Cat# A2228 RRID:AB_476697 Mouse anti-LAMP1 Santa Cruz Biotechnology Cat# sc-20011 RRID:AB_626853 Rabbit anti-phospho-GSK3b Cell Signaling Technology Cat# 5558 RRID:AB_10013750 Rabbit anti-GSK3b Cell Signaling Technology Cat# 12456 RRID:AB_2636978 Rabbit anti-PCNA Cell Signaling Technology Cat# 13110 RRID:AB_2636979 Rabbit anti-cleaved-caspase 3 Cell Signaling Technology Cat# 9664 RRID:AB_2070042 Goat anti-IBA1 Abcam Cat# ab5076 RRID:AB_2224402 Anti-Ab antibody MOAB-2 Biosensis Cat# M-1586-100 RRID:AB_2492497 Biological Samples For patient information, see Table S1 N/A Chemicals, Peptides, and Recombinant Proteins MG132 EMD Millipore Cat# 474790 Chloroquine Cell Signaling Technology Cat# 14774 Margatoxin Alomone Labs Cat# STM-325 Tertiapin Alomone Labs Cat# STT-250 Ab1-42 peptides Anaspec Cat# AS-20276 Biotin-Ab1-42 peptides Anaspec Cat# AS-23523 FAM-Ab1-42 peptides Anaspec Cat# AS-23525 Recombinant human IgG1 Fc R&D Systems Cat# 110-HG Recombinant human TREM2-Fc protein R&D Systems Cat# 1828-T2 Recombinant human TREM1-Fc protein R&D Systems Cat# 1278-TR Recombinant human CD36-Fc protein R&D Systems Cat# 1955-CD Recombinant human RAGE-Fc protein R&D Systems Cat# 1145-RG Recombinant human Gas6 protein R&D Systems Cat# 885-GSB Recombinant human MerTK-Fc protein R&D Systems Cat# 891-MR Recombinant human TREM2-His protein Sino Biological Cat# 11084-H08H Recombinant human TREM1-His protein Sino Biological Cat# 10511-H08H Critical Commercial Assays Human Ab1-42 ELISA kit Thermo Fisher Scientific Cat# KHB3441 Dynabeads protein G Thermo Fisher Scientific Cat# 10004D QuikChange II Site-Directed Mutagenesis kit Agilent Technologies Cat# 200523 Lipojet SignaGen Laboratories Cat# SL100468 (Continued on next page) e1 Neuron 97, 1023–1031.e1–e7, March 7, 2018 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental Models: Cell Lines BV2 KCB Cat# KCB 200770YJ RRID:CVCL_0182 BV2 overexpressing TREM2 This paper N/A HEK293T ATCC Cat# CRL-3216 RRID:CVCL_0063 Experimental Models: Organisms/Strains C57BL/6N Jackson Laboratories Cat# 005304 RRID:IMSR_JAX:005304 TREM2 KO mouse John Fryer (Atagi et al., 2015) Cat# KOMP:VG10093 RRID:IMSR_KOMP: VG10093 TgCRND8 mouse Peter St. George-Hyslop (Chishti et al., 2001) N/A Oligonucleotides TREM2 PCR primer, forward (AGGGCCCATGCCAGCGTGTGGT) Integrated DNA Technologies N/A TREM2 PCR primer, reverse (CCAGAGATCTCCAGCATC) Integrated DNA Technologies N/A GAPDH PCR primer, forward (CCCTTCATTGACCTCAACTA) Integrated DNA Technologies N/A GAPDH PCR primer, reverse (CCTTCTCCATGGTGGTGAA) Integrated DNA Technologies N/A IL-6 PCR primer, forward (TAGTCCTTCCTACCCCAATTTCC) Integrated DNA Technologies N/A IL-6 PCR primer, reverse (TTGGTCCTTAGCCACTCCTTC) Integrated DNA Technologies N/A MIP-1a PCR primer, forward (CCCAGCCAGGTGTCATTTTCC) Integrated DNA Technologies N/A MIP-1a PCR primer, reverse (GCATTCAGTTCCAGGTCAGTG) Integrated DNA Technologies N/A Arg1 PCR primer, forward (CACAGTCTGGCAGTTGGAAGC) Integrated DNA Technologies N/A Arg1 PCR primer, reverse (CTTTGGCAGATATGCAGGGAG) Integrated DNA Technologies N/A Recombinant DNA Lentiviral pReceiver-Lv228 vector GeneCopoeia EX-NEG-Lv228 Lentiviral pReceiver-Lv228-TREM2 vector GeneCopoeia EX-S0483-Lv228 pFUSE-hIgG1-Fc vector InvivoGen Cat# pfuse-hg1fc1 pFUSE-TREM2-hIgG1-Fc vector This paper N/A pFUSE-TREM2(R47H)-hIgG1-Fc vector This paper N/A pFUSE-TREM2(R62H)-hIgG1-Fc vector This paper N/A pEGFP-TREM2-N1 vector This paper N/A pmCherry-DAP12-N1 vector This paper N/A Software and Algorithms Fiji-ImageJ National Inst.

    Article Title: A bispecific nanobody-drug conjugate targeting TROP2 and c-Met for low-concentration, single-dose treatment of pancreatic cancer.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Alexa Fluor® 700-anti human TROP2 antibody R&D Systems Cat#FAB650N-100UG; RRID: AB_3651666 PE-anti human c-Met antibody Abcam Cat#ab279587; Temporary RRID:AB_3740207 TACSTD2/TROP2 Monoclonal antibody Wuhan Sanying Cat#68141-1-Ig; CloneNo.5A6B1; RRID: AB_3085043 c-Met (Cytoplasmic) Polyclonal antibody Wuhan Sanying Cat#25869-1-AP; RRID: AB_2880276 Goat anti-human IgG Fc (HRP) Abcam Cat#ab97225; RRID: AB_10680850 HRP conjugated Goat Anti-Mouse IgG (H + L) Servicebio Cat#GB23301; RRID: AB_2904020 HRP conjugated Goat Anti-Rabbit IgG (H + L) Servicebio Cat#GB23303; RRID: AB_2811189 DyLight 650-Goat anti human IgG Fc Thermo Fisher RRID: AB_2556717 Rabbit anti-MMAE antibody(YA899) MedChemExpress (MCE) RRID: AB_3103046 F(ab’)2-Goat anti-Rabbit IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa Fluor TM 647 Thermo Fisher RRID: AB_2535814 Goat anti-Human IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa Fluor TM 488 Thermo Fisher RRID: AB_2534080 Cleaved Caspase-3 (Asp175) Antibody #9661Cleaved-Caspase3 Cell Signaling Technology (CST) Cat#9661S; RRID: AB_2341188 Cleaved Caspase-9 (Asp330) (D2D4) Rabbit mAb #7237 Cell Signaling Technology (CST) Cat#7237T; RRID: AB_10895832 Recombinant Anti-Caspase-7 antibody (Mouse mAb) Servicebio Cat#GB15540-100; Temporary RRID: AB_3740208 Anti-Cleaved-Caspase-3 Rabbit pAb Servicebio Cat#GB11532-100; RRID: AB_3096316 Anti-Cleaved PARP1 Rabbit pAb Servicebio Cat#GB111503-100; RRID: AB_3711714 Anti-Ki67 Rabbit pAb Servicebio Cat#GB111499-100; RRID: AB_2927572 Anti-PCNA Mouse mAb Servicebio Cat#GB12010-100; RRID: AB_3714765 Bacterial and virus strains DH5α Competent Cells Shenzhen Comedi Life Sciences Cat#KTSM101L ER2738 Electrocompetent Cells Lucigen Cat#60522-1 Biological samples Multi-Organ Cancer Tissue Microarray (TMA) Shanghai Outdo Biotech Cat#HOrgC180PG01-1 Pancreatic Cancer Tissue Microarray (TMA) Shanghai Outdo Biotech Cat#HPanA120PG02 Normal Human Multi-Organ Tissue Microarray (TMA) Shanghai Outdo Biotech Cat#HOrgN120PT02 Patient-derived xenografts (PDX) Nanchang Royo Biotech Patient ID: RYP-748; Patient ID: RYP-1301 Chemicals, peptides, and recombinant proteins Monomethyl auristatin E(MMAE) MedChemExpress (MCE) HY-15162; CAS No.474645-27-7 mc-vc-PABC-MMAE MedChemExpress (MCE) HY-15575; CAS No.646502-53-6 Cyanine5.5 NHS ester Luminprobe Cat#47020 DyLight TM 633 NHS Ester Thermo Fisher Cat#46414 Beetle Luciferin, Potassium Salt Promega Cat#E1601 (Continued on next page) Cell Reports Medicine 7, 102688, April 21, 2026 e1 OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Phalloidin Labeling Probes Thermo Fisher Scientific Cat#A12379 PageRuler TM Prestained Protein Ladder Thermo Fisher Scientific Cat#26616 Sacituzumab govitecan MedChemExpress (MCE) HY-132254; CAS No.1491917-83-9 Telisotuzumab vedotin MedChemExpress (MCE) HY-141601; CAS No.1714088-51-3 Cathepsin B Protein, Human (His) MedChemExpress (MCE) Cat#HY-P70830 TROP2 Protein, Human, Recombinant (His Tag) Sinobiological Cat#10428-H08H c-MET Protein, Human, Recombinant (ECD, His Tag) Sinobiological Cat10692-H08H Critical commercial assays Opal 7-color Manual IHC Kit BIOMART.CN Cat#NEL811001KT Cell Cycle and Apoptosis Analysis Kit BEYOTIME Cat#C1052 Annexin V-FITC/PI Apoptosis Detection Kit BEYOTIME Cat#C1063 Cell Counting Kit-8 MedChemExpress (MCE) Cat#HY-K0301 Sensor Chip Protein A Cytiva Cat#10349316 Deposited data TROP2 protein structure This paper PDB: 7PEE c-Met protein structure This paper PDB: 2UZX TROP2 and c-Met expression profiles in patients with tumors versus healthy controls HPA (The Human Protein Atlas) HPA:https://www.proteinatlas.org/search/ tacstd2,; https://www.proteinatlas.org/ search/MET TROP2 and MET expression and survival in Cancers GEPIA2 http://gepia2.cancer-pku.cn/ GEPIA:http:// gepia.cancer-pku.cn/ detail.php?gene=TACSTD2; http:// gepia.cancer-pku.cn/ detail.php?gene=MET Experimental models: Cell lines BxPC-3 ATCC CRL-1687 TM NCI-H358 ATCC CRL-5807 TM SPC-A1 This paper N/A MDA-MB-231 ATCC HTB-26 TM HT-29 ATCC HTB-38 TM OVCAR3 ATCC HTB-161 TM SW1990 ATCC CRL-2172 TM HPAC ATCC CRL-2119 TM PANC02.03 ATCC CRL-2553 TM Capan-2 ATCC HTB-80 TM ASPC1 ATCC CRL-1682 TM HCT-116 ATCC CCL-247 TM HCC94 This paper N/A HUVEC ScienCell Cat#8000 MRC-5 ATCC CCL-171 TM 293T ATCC CRL-3216 TM HEK293 ATCC CRL-1573 TM Experimental models: Organisms/strains Mouse: BALB/cNj-Foxn1nu/Gpt GemPharmatech Cat#D000521 Mouse: NOD.Cg-PrkdcscidIl2rgem1Smoc Shanghai Model Organisms Cat#NM-NSG-001 Mouse: C57BL/6-Tacstd2tm1(TACSTD2) Bcgen/Bcgen Biocytogen Cat#110966 (Continued on next page) e2 Cell Reports Medicine 7, 102688, April 21, 2026 OPEN ACCESS .. The BxPC-3, NCI-H358, SPC-A1, MDA-MB-231, HT-29, OVCAR3, SW1990, HPAC, PANC02.03, Capan-2, ASPC1, HCT-116, HCC94, HUVEC and MRC5 cell lines were obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA).

    other:


    Article Title: Single-cell analysis of memory B cells from top neutralizers reveals multiple sites of vulnerability within HCMV Trimer and Pentamer.
    Article Snippet: In brief Vaccines against HCMV are not available, and treatment options are limited.. By dissecting the B cell response of HCMV top neutralizers, Zehner et al. reveal key epitopes for the neutralization of HCMV.. Structural analyses elucidate HCMV neutralization mechanisms, and highly potent and cross-neutralizing antibodies were identified.

    Labeling:

    Article Title: A bispecific nanobody-drug conjugate targeting TROP2 and c-Met for low-concentration, single-dose treatment of pancreatic cancer.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Alexa Fluor® 700-anti human TROP2 antibody R&D Systems Cat#FAB650N-100UG; RRID: AB_3651666 PE-anti human c-Met antibody Abcam Cat#ab279587; Temporary RRID:AB_3740207 TACSTD2/TROP2 Monoclonal antibody Wuhan Sanying Cat#68141-1-Ig; CloneNo.5A6B1; RRID: AB_3085043 c-Met (Cytoplasmic) Polyclonal antibody Wuhan Sanying Cat#25869-1-AP; RRID: AB_2880276 Goat anti-human IgG Fc (HRP) Abcam Cat#ab97225; RRID: AB_10680850 HRP conjugated Goat Anti-Mouse IgG (H + L) Servicebio Cat#GB23301; RRID: AB_2904020 HRP conjugated Goat Anti-Rabbit IgG (H + L) Servicebio Cat#GB23303; RRID: AB_2811189 DyLight 650-Goat anti human IgG Fc Thermo Fisher RRID: AB_2556717 Rabbit anti-MMAE antibody(YA899) MedChemExpress (MCE) RRID: AB_3103046 F(ab’)2-Goat anti-Rabbit IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa Fluor TM 647 Thermo Fisher RRID: AB_2535814 Goat anti-Human IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa Fluor TM 488 Thermo Fisher RRID: AB_2534080 Cleaved Caspase-3 (Asp175) Antibody #9661Cleaved-Caspase3 Cell Signaling Technology (CST) Cat#9661S; RRID: AB_2341188 Cleaved Caspase-9 (Asp330) (D2D4) Rabbit mAb #7237 Cell Signaling Technology (CST) Cat#7237T; RRID: AB_10895832 Recombinant Anti-Caspase-7 antibody (Mouse mAb) Servicebio Cat#GB15540-100; Temporary RRID: AB_3740208 Anti-Cleaved-Caspase-3 Rabbit pAb Servicebio Cat#GB11532-100; RRID: AB_3096316 Anti-Cleaved PARP1 Rabbit pAb Servicebio Cat#GB111503-100; RRID: AB_3711714 Anti-Ki67 Rabbit pAb Servicebio Cat#GB111499-100; RRID: AB_2927572 Anti-PCNA Mouse mAb Servicebio Cat#GB12010-100; RRID: AB_3714765 Bacterial and virus strains DH5α Competent Cells Shenzhen Comedi Life Sciences Cat#KTSM101L ER2738 Electrocompetent Cells Lucigen Cat#60522-1 Biological samples Multi-Organ Cancer Tissue Microarray (TMA) Shanghai Outdo Biotech Cat#HOrgC180PG01-1 Pancreatic Cancer Tissue Microarray (TMA) Shanghai Outdo Biotech Cat#HPanA120PG02 Normal Human Multi-Organ Tissue Microarray (TMA) Shanghai Outdo Biotech Cat#HOrgN120PT02 Patient-derived xenografts (PDX) Nanchang Royo Biotech Patient ID: RYP-748; Patient ID: RYP-1301 Chemicals, peptides, and recombinant proteins Monomethyl auristatin E(MMAE) MedChemExpress (MCE) HY-15162; CAS No.474645-27-7 mc-vc-PABC-MMAE MedChemExpress (MCE) HY-15575; CAS No.646502-53-6 Cyanine5.5 NHS ester Luminprobe Cat#47020 DyLight TM 633 NHS Ester Thermo Fisher Cat#46414 Beetle Luciferin, Potassium Salt Promega Cat#E1601 (Continued on next page) Cell Reports Medicine 7, 102688, April 21, 2026 e1 OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Phalloidin Labeling Probes Thermo Fisher Scientific Cat#A12379 PageRuler TM Prestained Protein Ladder Thermo Fisher Scientific Cat#26616 Sacituzumab govitecan MedChemExpress (MCE) HY-132254; CAS No.1491917-83-9 Telisotuzumab vedotin MedChemExpress (MCE) HY-141601; CAS No.1714088-51-3 Cathepsin B Protein, Human (His) MedChemExpress (MCE) Cat#HY-P70830 TROP2 Protein, Human, Recombinant (His Tag) Sinobiological Cat#10428-H08H c-MET Protein, Human, Recombinant (ECD, His Tag) Sinobiological Cat10692-H08H Critical commercial assays Opal 7-color Manual IHC Kit BIOMART.CN Cat#NEL811001KT Cell Cycle and Apoptosis Analysis Kit BEYOTIME Cat#C1052 Annexin V-FITC/PI Apoptosis Detection Kit BEYOTIME Cat#C1063 Cell Counting Kit-8 MedChemExpress (MCE) Cat#HY-K0301 Sensor Chip Protein A Cytiva Cat#10349316 Deposited data TROP2 protein structure This paper PDB: 7PEE c-Met protein structure This paper PDB: 2UZX TROP2 and c-Met expression profiles in patients with tumors versus healthy controls HPA (The Human Protein Atlas) HPA:https://www.proteinatlas.org/search/ tacstd2,; https://www.proteinatlas.org/ search/MET TROP2 and MET expression and survival in Cancers GEPIA2 http://gepia2.cancer-pku.cn/ GEPIA:http:// gepia.cancer-pku.cn/ detail.php?gene=TACSTD2; http:// gepia.cancer-pku.cn/ detail.php?gene=MET Experimental models: Cell lines BxPC-3 ATCC CRL-1687 TM NCI-H358 ATCC CRL-5807 TM SPC-A1 This paper N/A MDA-MB-231 ATCC HTB-26 TM HT-29 ATCC HTB-38 TM OVCAR3 ATCC HTB-161 TM SW1990 ATCC CRL-2172 TM HPAC ATCC CRL-2119 TM PANC02.03 ATCC CRL-2553 TM Capan-2 ATCC HTB-80 TM ASPC1 ATCC CRL-1682 TM HCT-116 ATCC CCL-247 TM HCC94 This paper N/A HUVEC ScienCell Cat#8000 MRC-5 ATCC CCL-171 TM 293T ATCC CRL-3216 TM HEK293 ATCC CRL-1573 TM Experimental models: Organisms/strains Mouse: BALB/cNj-Foxn1nu/Gpt GemPharmatech Cat#D000521 Mouse: NOD.Cg-PrkdcscidIl2rgem1Smoc Shanghai Model Organisms Cat#NM-NSG-001 Mouse: C57BL/6-Tacstd2tm1(TACSTD2) Bcgen/Bcgen Biocytogen Cat#110966 (Continued on next page) e2 Cell Reports Medicine 7, 102688, April 21, 2026 OPEN ACCESS .. The BxPC-3, NCI-H358, SPC-A1, MDA-MB-231, HT-29, OVCAR3, SW1990, HPAC, PANC02.03, Capan-2, ASPC1, HCT-116, HCC94, HUVEC and MRC5 cell lines were obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA).

    Immunohistochemistry:

    Article Title: A bispecific nanobody-drug conjugate targeting TROP2 and c-Met for low-concentration, single-dose treatment of pancreatic cancer.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Alexa Fluor® 700-anti human TROP2 antibody R&D Systems Cat#FAB650N-100UG; RRID: AB_3651666 PE-anti human c-Met antibody Abcam Cat#ab279587; Temporary RRID:AB_3740207 TACSTD2/TROP2 Monoclonal antibody Wuhan Sanying Cat#68141-1-Ig; CloneNo.5A6B1; RRID: AB_3085043 c-Met (Cytoplasmic) Polyclonal antibody Wuhan Sanying Cat#25869-1-AP; RRID: AB_2880276 Goat anti-human IgG Fc (HRP) Abcam Cat#ab97225; RRID: AB_10680850 HRP conjugated Goat Anti-Mouse IgG (H + L) Servicebio Cat#GB23301; RRID: AB_2904020 HRP conjugated Goat Anti-Rabbit IgG (H + L) Servicebio Cat#GB23303; RRID: AB_2811189 DyLight 650-Goat anti human IgG Fc Thermo Fisher RRID: AB_2556717 Rabbit anti-MMAE antibody(YA899) MedChemExpress (MCE) RRID: AB_3103046 F(ab’)2-Goat anti-Rabbit IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa Fluor TM 647 Thermo Fisher RRID: AB_2535814 Goat anti-Human IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa Fluor TM 488 Thermo Fisher RRID: AB_2534080 Cleaved Caspase-3 (Asp175) Antibody #9661Cleaved-Caspase3 Cell Signaling Technology (CST) Cat#9661S; RRID: AB_2341188 Cleaved Caspase-9 (Asp330) (D2D4) Rabbit mAb #7237 Cell Signaling Technology (CST) Cat#7237T; RRID: AB_10895832 Recombinant Anti-Caspase-7 antibody (Mouse mAb) Servicebio Cat#GB15540-100; Temporary RRID: AB_3740208 Anti-Cleaved-Caspase-3 Rabbit pAb Servicebio Cat#GB11532-100; RRID: AB_3096316 Anti-Cleaved PARP1 Rabbit pAb Servicebio Cat#GB111503-100; RRID: AB_3711714 Anti-Ki67 Rabbit pAb Servicebio Cat#GB111499-100; RRID: AB_2927572 Anti-PCNA Mouse mAb Servicebio Cat#GB12010-100; RRID: AB_3714765 Bacterial and virus strains DH5α Competent Cells Shenzhen Comedi Life Sciences Cat#KTSM101L ER2738 Electrocompetent Cells Lucigen Cat#60522-1 Biological samples Multi-Organ Cancer Tissue Microarray (TMA) Shanghai Outdo Biotech Cat#HOrgC180PG01-1 Pancreatic Cancer Tissue Microarray (TMA) Shanghai Outdo Biotech Cat#HPanA120PG02 Normal Human Multi-Organ Tissue Microarray (TMA) Shanghai Outdo Biotech Cat#HOrgN120PT02 Patient-derived xenografts (PDX) Nanchang Royo Biotech Patient ID: RYP-748; Patient ID: RYP-1301 Chemicals, peptides, and recombinant proteins Monomethyl auristatin E(MMAE) MedChemExpress (MCE) HY-15162; CAS No.474645-27-7 mc-vc-PABC-MMAE MedChemExpress (MCE) HY-15575; CAS No.646502-53-6 Cyanine5.5 NHS ester Luminprobe Cat#47020 DyLight TM 633 NHS Ester Thermo Fisher Cat#46414 Beetle Luciferin, Potassium Salt Promega Cat#E1601 (Continued on next page) Cell Reports Medicine 7, 102688, April 21, 2026 e1 OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Phalloidin Labeling Probes Thermo Fisher Scientific Cat#A12379 PageRuler TM Prestained Protein Ladder Thermo Fisher Scientific Cat#26616 Sacituzumab govitecan MedChemExpress (MCE) HY-132254; CAS No.1491917-83-9 Telisotuzumab vedotin MedChemExpress (MCE) HY-141601; CAS No.1714088-51-3 Cathepsin B Protein, Human (His) MedChemExpress (MCE) Cat#HY-P70830 TROP2 Protein, Human, Recombinant (His Tag) Sinobiological Cat#10428-H08H c-MET Protein, Human, Recombinant (ECD, His Tag) Sinobiological Cat10692-H08H Critical commercial assays Opal 7-color Manual IHC Kit BIOMART.CN Cat#NEL811001KT Cell Cycle and Apoptosis Analysis Kit BEYOTIME Cat#C1052 Annexin V-FITC/PI Apoptosis Detection Kit BEYOTIME Cat#C1063 Cell Counting Kit-8 MedChemExpress (MCE) Cat#HY-K0301 Sensor Chip Protein A Cytiva Cat#10349316 Deposited data TROP2 protein structure This paper PDB: 7PEE c-Met protein structure This paper PDB: 2UZX TROP2 and c-Met expression profiles in patients with tumors versus healthy controls HPA (The Human Protein Atlas) HPA:https://www.proteinatlas.org/search/ tacstd2,; https://www.proteinatlas.org/ search/MET TROP2 and MET expression and survival in Cancers GEPIA2 http://gepia2.cancer-pku.cn/ GEPIA:http:// gepia.cancer-pku.cn/ detail.php?gene=TACSTD2; http:// gepia.cancer-pku.cn/ detail.php?gene=MET Experimental models: Cell lines BxPC-3 ATCC CRL-1687 TM NCI-H358 ATCC CRL-5807 TM SPC-A1 This paper N/A MDA-MB-231 ATCC HTB-26 TM HT-29 ATCC HTB-38 TM OVCAR3 ATCC HTB-161 TM SW1990 ATCC CRL-2172 TM HPAC ATCC CRL-2119 TM PANC02.03 ATCC CRL-2553 TM Capan-2 ATCC HTB-80 TM ASPC1 ATCC CRL-1682 TM HCT-116 ATCC CCL-247 TM HCC94 This paper N/A HUVEC ScienCell Cat#8000 MRC-5 ATCC CCL-171 TM 293T ATCC CRL-3216 TM HEK293 ATCC CRL-1573 TM Experimental models: Organisms/strains Mouse: BALB/cNj-Foxn1nu/Gpt GemPharmatech Cat#D000521 Mouse: NOD.Cg-PrkdcscidIl2rgem1Smoc Shanghai Model Organisms Cat#NM-NSG-001 Mouse: C57BL/6-Tacstd2tm1(TACSTD2) Bcgen/Bcgen Biocytogen Cat#110966 (Continued on next page) e2 Cell Reports Medicine 7, 102688, April 21, 2026 OPEN ACCESS .. The BxPC-3, NCI-H358, SPC-A1, MDA-MB-231, HT-29, OVCAR3, SW1990, HPAC, PANC02.03, Capan-2, ASPC1, HCT-116, HCC94, HUVEC and MRC5 cell lines were obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA).

    CCK-8 Assay:

    Article Title: A bispecific nanobody-drug conjugate targeting TROP2 and c-Met for low-concentration, single-dose treatment of pancreatic cancer.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Alexa Fluor® 700-anti human TROP2 antibody R&D Systems Cat#FAB650N-100UG; RRID: AB_3651666 PE-anti human c-Met antibody Abcam Cat#ab279587; Temporary RRID:AB_3740207 TACSTD2/TROP2 Monoclonal antibody Wuhan Sanying Cat#68141-1-Ig; CloneNo.5A6B1; RRID: AB_3085043 c-Met (Cytoplasmic) Polyclonal antibody Wuhan Sanying Cat#25869-1-AP; RRID: AB_2880276 Goat anti-human IgG Fc (HRP) Abcam Cat#ab97225; RRID: AB_10680850 HRP conjugated Goat Anti-Mouse IgG (H + L) Servicebio Cat#GB23301; RRID: AB_2904020 HRP conjugated Goat Anti-Rabbit IgG (H + L) Servicebio Cat#GB23303; RRID: AB_2811189 DyLight 650-Goat anti human IgG Fc Thermo Fisher RRID: AB_2556717 Rabbit anti-MMAE antibody(YA899) MedChemExpress (MCE) RRID: AB_3103046 F(ab’)2-Goat anti-Rabbit IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa Fluor TM 647 Thermo Fisher RRID: AB_2535814 Goat anti-Human IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa Fluor TM 488 Thermo Fisher RRID: AB_2534080 Cleaved Caspase-3 (Asp175) Antibody #9661Cleaved-Caspase3 Cell Signaling Technology (CST) Cat#9661S; RRID: AB_2341188 Cleaved Caspase-9 (Asp330) (D2D4) Rabbit mAb #7237 Cell Signaling Technology (CST) Cat#7237T; RRID: AB_10895832 Recombinant Anti-Caspase-7 antibody (Mouse mAb) Servicebio Cat#GB15540-100; Temporary RRID: AB_3740208 Anti-Cleaved-Caspase-3 Rabbit pAb Servicebio Cat#GB11532-100; RRID: AB_3096316 Anti-Cleaved PARP1 Rabbit pAb Servicebio Cat#GB111503-100; RRID: AB_3711714 Anti-Ki67 Rabbit pAb Servicebio Cat#GB111499-100; RRID: AB_2927572 Anti-PCNA Mouse mAb Servicebio Cat#GB12010-100; RRID: AB_3714765 Bacterial and virus strains DH5α Competent Cells Shenzhen Comedi Life Sciences Cat#KTSM101L ER2738 Electrocompetent Cells Lucigen Cat#60522-1 Biological samples Multi-Organ Cancer Tissue Microarray (TMA) Shanghai Outdo Biotech Cat#HOrgC180PG01-1 Pancreatic Cancer Tissue Microarray (TMA) Shanghai Outdo Biotech Cat#HPanA120PG02 Normal Human Multi-Organ Tissue Microarray (TMA) Shanghai Outdo Biotech Cat#HOrgN120PT02 Patient-derived xenografts (PDX) Nanchang Royo Biotech Patient ID: RYP-748; Patient ID: RYP-1301 Chemicals, peptides, and recombinant proteins Monomethyl auristatin E(MMAE) MedChemExpress (MCE) HY-15162; CAS No.474645-27-7 mc-vc-PABC-MMAE MedChemExpress (MCE) HY-15575; CAS No.646502-53-6 Cyanine5.5 NHS ester Luminprobe Cat#47020 DyLight TM 633 NHS Ester Thermo Fisher Cat#46414 Beetle Luciferin, Potassium Salt Promega Cat#E1601 (Continued on next page) Cell Reports Medicine 7, 102688, April 21, 2026 e1 OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Phalloidin Labeling Probes Thermo Fisher Scientific Cat#A12379 PageRuler TM Prestained Protein Ladder Thermo Fisher Scientific Cat#26616 Sacituzumab govitecan MedChemExpress (MCE) HY-132254; CAS No.1491917-83-9 Telisotuzumab vedotin MedChemExpress (MCE) HY-141601; CAS No.1714088-51-3 Cathepsin B Protein, Human (His) MedChemExpress (MCE) Cat#HY-P70830 TROP2 Protein, Human, Recombinant (His Tag) Sinobiological Cat#10428-H08H c-MET Protein, Human, Recombinant (ECD, His Tag) Sinobiological Cat10692-H08H Critical commercial assays Opal 7-color Manual IHC Kit BIOMART.CN Cat#NEL811001KT Cell Cycle and Apoptosis Analysis Kit BEYOTIME Cat#C1052 Annexin V-FITC/PI Apoptosis Detection Kit BEYOTIME Cat#C1063 Cell Counting Kit-8 MedChemExpress (MCE) Cat#HY-K0301 Sensor Chip Protein A Cytiva Cat#10349316 Deposited data TROP2 protein structure This paper PDB: 7PEE c-Met protein structure This paper PDB: 2UZX TROP2 and c-Met expression profiles in patients with tumors versus healthy controls HPA (The Human Protein Atlas) HPA:https://www.proteinatlas.org/search/ tacstd2,; https://www.proteinatlas.org/ search/MET TROP2 and MET expression and survival in Cancers GEPIA2 http://gepia2.cancer-pku.cn/ GEPIA:http:// gepia.cancer-pku.cn/ detail.php?gene=TACSTD2; http:// gepia.cancer-pku.cn/ detail.php?gene=MET Experimental models: Cell lines BxPC-3 ATCC CRL-1687 TM NCI-H358 ATCC CRL-5807 TM SPC-A1 This paper N/A MDA-MB-231 ATCC HTB-26 TM HT-29 ATCC HTB-38 TM OVCAR3 ATCC HTB-161 TM SW1990 ATCC CRL-2172 TM HPAC ATCC CRL-2119 TM PANC02.03 ATCC CRL-2553 TM Capan-2 ATCC HTB-80 TM ASPC1 ATCC CRL-1682 TM HCT-116 ATCC CCL-247 TM HCC94 This paper N/A HUVEC ScienCell Cat#8000 MRC-5 ATCC CCL-171 TM 293T ATCC CRL-3216 TM HEK293 ATCC CRL-1573 TM Experimental models: Organisms/strains Mouse: BALB/cNj-Foxn1nu/Gpt GemPharmatech Cat#D000521 Mouse: NOD.Cg-PrkdcscidIl2rgem1Smoc Shanghai Model Organisms Cat#NM-NSG-001 Mouse: C57BL/6-Tacstd2tm1(TACSTD2) Bcgen/Bcgen Biocytogen Cat#110966 (Continued on next page) e2 Cell Reports Medicine 7, 102688, April 21, 2026 OPEN ACCESS .. The BxPC-3, NCI-H358, SPC-A1, MDA-MB-231, HT-29, OVCAR3, SW1990, HPAC, PANC02.03, Capan-2, ASPC1, HCT-116, HCC94, HUVEC and MRC5 cell lines were obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA).

    Expressing:

    Article Title: A bispecific nanobody-drug conjugate targeting TROP2 and c-Met for low-concentration, single-dose treatment of pancreatic cancer.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Alexa Fluor® 700-anti human TROP2 antibody R&D Systems Cat#FAB650N-100UG; RRID: AB_3651666 PE-anti human c-Met antibody Abcam Cat#ab279587; Temporary RRID:AB_3740207 TACSTD2/TROP2 Monoclonal antibody Wuhan Sanying Cat#68141-1-Ig; CloneNo.5A6B1; RRID: AB_3085043 c-Met (Cytoplasmic) Polyclonal antibody Wuhan Sanying Cat#25869-1-AP; RRID: AB_2880276 Goat anti-human IgG Fc (HRP) Abcam Cat#ab97225; RRID: AB_10680850 HRP conjugated Goat Anti-Mouse IgG (H + L) Servicebio Cat#GB23301; RRID: AB_2904020 HRP conjugated Goat Anti-Rabbit IgG (H + L) Servicebio Cat#GB23303; RRID: AB_2811189 DyLight 650-Goat anti human IgG Fc Thermo Fisher RRID: AB_2556717 Rabbit anti-MMAE antibody(YA899) MedChemExpress (MCE) RRID: AB_3103046 F(ab’)2-Goat anti-Rabbit IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa Fluor TM 647 Thermo Fisher RRID: AB_2535814 Goat anti-Human IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa Fluor TM 488 Thermo Fisher RRID: AB_2534080 Cleaved Caspase-3 (Asp175) Antibody #9661Cleaved-Caspase3 Cell Signaling Technology (CST) Cat#9661S; RRID: AB_2341188 Cleaved Caspase-9 (Asp330) (D2D4) Rabbit mAb #7237 Cell Signaling Technology (CST) Cat#7237T; RRID: AB_10895832 Recombinant Anti-Caspase-7 antibody (Mouse mAb) Servicebio Cat#GB15540-100; Temporary RRID: AB_3740208 Anti-Cleaved-Caspase-3 Rabbit pAb Servicebio Cat#GB11532-100; RRID: AB_3096316 Anti-Cleaved PARP1 Rabbit pAb Servicebio Cat#GB111503-100; RRID: AB_3711714 Anti-Ki67 Rabbit pAb Servicebio Cat#GB111499-100; RRID: AB_2927572 Anti-PCNA Mouse mAb Servicebio Cat#GB12010-100; RRID: AB_3714765 Bacterial and virus strains DH5α Competent Cells Shenzhen Comedi Life Sciences Cat#KTSM101L ER2738 Electrocompetent Cells Lucigen Cat#60522-1 Biological samples Multi-Organ Cancer Tissue Microarray (TMA) Shanghai Outdo Biotech Cat#HOrgC180PG01-1 Pancreatic Cancer Tissue Microarray (TMA) Shanghai Outdo Biotech Cat#HPanA120PG02 Normal Human Multi-Organ Tissue Microarray (TMA) Shanghai Outdo Biotech Cat#HOrgN120PT02 Patient-derived xenografts (PDX) Nanchang Royo Biotech Patient ID: RYP-748; Patient ID: RYP-1301 Chemicals, peptides, and recombinant proteins Monomethyl auristatin E(MMAE) MedChemExpress (MCE) HY-15162; CAS No.474645-27-7 mc-vc-PABC-MMAE MedChemExpress (MCE) HY-15575; CAS No.646502-53-6 Cyanine5.5 NHS ester Luminprobe Cat#47020 DyLight TM 633 NHS Ester Thermo Fisher Cat#46414 Beetle Luciferin, Potassium Salt Promega Cat#E1601 (Continued on next page) Cell Reports Medicine 7, 102688, April 21, 2026 e1 OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Phalloidin Labeling Probes Thermo Fisher Scientific Cat#A12379 PageRuler TM Prestained Protein Ladder Thermo Fisher Scientific Cat#26616 Sacituzumab govitecan MedChemExpress (MCE) HY-132254; CAS No.1491917-83-9 Telisotuzumab vedotin MedChemExpress (MCE) HY-141601; CAS No.1714088-51-3 Cathepsin B Protein, Human (His) MedChemExpress (MCE) Cat#HY-P70830 TROP2 Protein, Human, Recombinant (His Tag) Sinobiological Cat#10428-H08H c-MET Protein, Human, Recombinant (ECD, His Tag) Sinobiological Cat10692-H08H Critical commercial assays Opal 7-color Manual IHC Kit BIOMART.CN Cat#NEL811001KT Cell Cycle and Apoptosis Analysis Kit BEYOTIME Cat#C1052 Annexin V-FITC/PI Apoptosis Detection Kit BEYOTIME Cat#C1063 Cell Counting Kit-8 MedChemExpress (MCE) Cat#HY-K0301 Sensor Chip Protein A Cytiva Cat#10349316 Deposited data TROP2 protein structure This paper PDB: 7PEE c-Met protein structure This paper PDB: 2UZX TROP2 and c-Met expression profiles in patients with tumors versus healthy controls HPA (The Human Protein Atlas) HPA:https://www.proteinatlas.org/search/ tacstd2,; https://www.proteinatlas.org/ search/MET TROP2 and MET expression and survival in Cancers GEPIA2 http://gepia2.cancer-pku.cn/ GEPIA:http:// gepia.cancer-pku.cn/ detail.php?gene=TACSTD2; http:// gepia.cancer-pku.cn/ detail.php?gene=MET Experimental models: Cell lines BxPC-3 ATCC CRL-1687 TM NCI-H358 ATCC CRL-5807 TM SPC-A1 This paper N/A MDA-MB-231 ATCC HTB-26 TM HT-29 ATCC HTB-38 TM OVCAR3 ATCC HTB-161 TM SW1990 ATCC CRL-2172 TM HPAC ATCC CRL-2119 TM PANC02.03 ATCC CRL-2553 TM Capan-2 ATCC HTB-80 TM ASPC1 ATCC CRL-1682 TM HCT-116 ATCC CCL-247 TM HCC94 This paper N/A HUVEC ScienCell Cat#8000 MRC-5 ATCC CCL-171 TM 293T ATCC CRL-3216 TM HEK293 ATCC CRL-1573 TM Experimental models: Organisms/strains Mouse: BALB/cNj-Foxn1nu/Gpt GemPharmatech Cat#D000521 Mouse: NOD.Cg-PrkdcscidIl2rgem1Smoc Shanghai Model Organisms Cat#NM-NSG-001 Mouse: C57BL/6-Tacstd2tm1(TACSTD2) Bcgen/Bcgen Biocytogen Cat#110966 (Continued on next page) e2 Cell Reports Medicine 7, 102688, April 21, 2026 OPEN ACCESS .. The BxPC-3, NCI-H358, SPC-A1, MDA-MB-231, HT-29, OVCAR3, SW1990, HPAC, PANC02.03, Capan-2, ASPC1, HCT-116, HCC94, HUVEC and MRC5 cell lines were obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA).

    Multiple Displacement Amplification:

    Article Title: A bispecific nanobody-drug conjugate targeting TROP2 and c-Met for low-concentration, single-dose treatment of pancreatic cancer.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Alexa Fluor® 700-anti human TROP2 antibody R&D Systems Cat#FAB650N-100UG; RRID: AB_3651666 PE-anti human c-Met antibody Abcam Cat#ab279587; Temporary RRID:AB_3740207 TACSTD2/TROP2 Monoclonal antibody Wuhan Sanying Cat#68141-1-Ig; CloneNo.5A6B1; RRID: AB_3085043 c-Met (Cytoplasmic) Polyclonal antibody Wuhan Sanying Cat#25869-1-AP; RRID: AB_2880276 Goat anti-human IgG Fc (HRP) Abcam Cat#ab97225; RRID: AB_10680850 HRP conjugated Goat Anti-Mouse IgG (H + L) Servicebio Cat#GB23301; RRID: AB_2904020 HRP conjugated Goat Anti-Rabbit IgG (H + L) Servicebio Cat#GB23303; RRID: AB_2811189 DyLight 650-Goat anti human IgG Fc Thermo Fisher RRID: AB_2556717 Rabbit anti-MMAE antibody(YA899) MedChemExpress (MCE) RRID: AB_3103046 F(ab’)2-Goat anti-Rabbit IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa Fluor TM 647 Thermo Fisher RRID: AB_2535814 Goat anti-Human IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa Fluor TM 488 Thermo Fisher RRID: AB_2534080 Cleaved Caspase-3 (Asp175) Antibody #9661Cleaved-Caspase3 Cell Signaling Technology (CST) Cat#9661S; RRID: AB_2341188 Cleaved Caspase-9 (Asp330) (D2D4) Rabbit mAb #7237 Cell Signaling Technology (CST) Cat#7237T; RRID: AB_10895832 Recombinant Anti-Caspase-7 antibody (Mouse mAb) Servicebio Cat#GB15540-100; Temporary RRID: AB_3740208 Anti-Cleaved-Caspase-3 Rabbit pAb Servicebio Cat#GB11532-100; RRID: AB_3096316 Anti-Cleaved PARP1 Rabbit pAb Servicebio Cat#GB111503-100; RRID: AB_3711714 Anti-Ki67 Rabbit pAb Servicebio Cat#GB111499-100; RRID: AB_2927572 Anti-PCNA Mouse mAb Servicebio Cat#GB12010-100; RRID: AB_3714765 Bacterial and virus strains DH5α Competent Cells Shenzhen Comedi Life Sciences Cat#KTSM101L ER2738 Electrocompetent Cells Lucigen Cat#60522-1 Biological samples Multi-Organ Cancer Tissue Microarray (TMA) Shanghai Outdo Biotech Cat#HOrgC180PG01-1 Pancreatic Cancer Tissue Microarray (TMA) Shanghai Outdo Biotech Cat#HPanA120PG02 Normal Human Multi-Organ Tissue Microarray (TMA) Shanghai Outdo Biotech Cat#HOrgN120PT02 Patient-derived xenografts (PDX) Nanchang Royo Biotech Patient ID: RYP-748; Patient ID: RYP-1301 Chemicals, peptides, and recombinant proteins Monomethyl auristatin E(MMAE) MedChemExpress (MCE) HY-15162; CAS No.474645-27-7 mc-vc-PABC-MMAE MedChemExpress (MCE) HY-15575; CAS No.646502-53-6 Cyanine5.5 NHS ester Luminprobe Cat#47020 DyLight TM 633 NHS Ester Thermo Fisher Cat#46414 Beetle Luciferin, Potassium Salt Promega Cat#E1601 (Continued on next page) Cell Reports Medicine 7, 102688, April 21, 2026 e1 OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Phalloidin Labeling Probes Thermo Fisher Scientific Cat#A12379 PageRuler TM Prestained Protein Ladder Thermo Fisher Scientific Cat#26616 Sacituzumab govitecan MedChemExpress (MCE) HY-132254; CAS No.1491917-83-9 Telisotuzumab vedotin MedChemExpress (MCE) HY-141601; CAS No.1714088-51-3 Cathepsin B Protein, Human (His) MedChemExpress (MCE) Cat#HY-P70830 TROP2 Protein, Human, Recombinant (His Tag) Sinobiological Cat#10428-H08H c-MET Protein, Human, Recombinant (ECD, His Tag) Sinobiological Cat10692-H08H Critical commercial assays Opal 7-color Manual IHC Kit BIOMART.CN Cat#NEL811001KT Cell Cycle and Apoptosis Analysis Kit BEYOTIME Cat#C1052 Annexin V-FITC/PI Apoptosis Detection Kit BEYOTIME Cat#C1063 Cell Counting Kit-8 MedChemExpress (MCE) Cat#HY-K0301 Sensor Chip Protein A Cytiva Cat#10349316 Deposited data TROP2 protein structure This paper PDB: 7PEE c-Met protein structure This paper PDB: 2UZX TROP2 and c-Met expression profiles in patients with tumors versus healthy controls HPA (The Human Protein Atlas) HPA:https://www.proteinatlas.org/search/ tacstd2,; https://www.proteinatlas.org/ search/MET TROP2 and MET expression and survival in Cancers GEPIA2 http://gepia2.cancer-pku.cn/ GEPIA:http:// gepia.cancer-pku.cn/ detail.php?gene=TACSTD2; http:// gepia.cancer-pku.cn/ detail.php?gene=MET Experimental models: Cell lines BxPC-3 ATCC CRL-1687 TM NCI-H358 ATCC CRL-5807 TM SPC-A1 This paper N/A MDA-MB-231 ATCC HTB-26 TM HT-29 ATCC HTB-38 TM OVCAR3 ATCC HTB-161 TM SW1990 ATCC CRL-2172 TM HPAC ATCC CRL-2119 TM PANC02.03 ATCC CRL-2553 TM Capan-2 ATCC HTB-80 TM ASPC1 ATCC CRL-1682 TM HCT-116 ATCC CCL-247 TM HCC94 This paper N/A HUVEC ScienCell Cat#8000 MRC-5 ATCC CCL-171 TM 293T ATCC CRL-3216 TM HEK293 ATCC CRL-1573 TM Experimental models: Organisms/strains Mouse: BALB/cNj-Foxn1nu/Gpt GemPharmatech Cat#D000521 Mouse: NOD.Cg-PrkdcscidIl2rgem1Smoc Shanghai Model Organisms Cat#NM-NSG-001 Mouse: C57BL/6-Tacstd2tm1(TACSTD2) Bcgen/Bcgen Biocytogen Cat#110966 (Continued on next page) e2 Cell Reports Medicine 7, 102688, April 21, 2026 OPEN ACCESS .. The BxPC-3, NCI-H358, SPC-A1, MDA-MB-231, HT-29, OVCAR3, SW1990, HPAC, PANC02.03, Capan-2, ASPC1, HCT-116, HCC94, HUVEC and MRC5 cell lines were obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA).



    Similar Products

    h08h critical  (Sino Biological)
    95
    Sino Biological h08h critical
    H08h Critical, supplied by Sino Biological, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/h08h+critical/Human+c-MET+%2F+HGFR+Protein/pm41856115-223-59-58
    Average 95 stars, based on 1 article reviews
    h08h critical - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier

    Image Search Results